View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_63 (Length: 226)
Name: NF14138_high_63
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 213
Target Start/End: Complemental strand, 5684255 - 5684068
Alignment:
| Q |
22 |
tgggttttggacggggttggataaggtgtgcagattctctgctgattataaaatgccgccgcagtcacatatccaaagaaaacctcatccatccgatcaa |
121 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
5684255 |
tgggttttggacagggttggataaggtgtgcagattctctgctgttaataaaatgccgccgcagtcacatattcaaagaaaacctcagccatccgatcaa |
5684156 |
T |
|
| Q |
122 |
tcctgcggttcagatctaacttttcaattttcccgcgaacactttcaacaagatagtagaaattgaagttgtcaatcttcccttatctccct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5684155 |
tcctgcggttcagatctaacttttcaattttcccgcgaacacttt---caagatagtagaaattgaagtt-tcaatcttcccttatctccct |
5684068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University