View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_65 (Length: 220)
Name: NF14138_high_65
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 83 - 135
Target Start/End: Complemental strand, 20457777 - 20457725
Alignment:
| Q |
83 |
aactaatggttatactaaaataattaatttagcccagttaaaatgaaattaat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20457777 |
aactaatggttatactaaaataattaatttagcccagttaaaatgaaattaat |
20457725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 20457640 - 20457603
Alignment:
| Q |
165 |
agaattattttatagttataaagaatatacttaatcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20457640 |
agaattattttatagttataaagaatatacttaatcat |
20457603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University