View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_69 (Length: 204)
Name: NF14138_high_69
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_69 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 133 - 204
Target Start/End: Original strand, 54909835 - 54909906
Alignment:
| Q |
133 |
gtcaactctacactccctagcttcaccaaacaatattactaacctatgtcaacttgctttgatccagtaaca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54909835 |
gtcaactctacactccctagcttcaccaaacaatattactaacctatttcaacttgctttgatccagtaaca |
54909906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 54909703 - 54909748
Alignment:
| Q |
1 |
taggaactggtattgatactgcggaaatatcctctacaattacaac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909703 |
taggaactggtattgatactgcggaaatatcctctacaattacaac |
54909748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University