View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14138_low_32 (Length: 348)

Name: NF14138_low_32
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14138_low_32
NF14138_low_32
[»] chr2 (1 HSPs)
chr2 (18-277)||(22806783-22807042)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 22806783 - 22807042
Alignment:
18 acatgtacagatcaaaaggtctttattcaggtt-gtaacggggccaaggtacatgtgagataaacctaaggaatactaagccataaatcaaataggataa 116  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||| |||| |||||||| || |||||||    
22806783 acatgtacagatcaaaaggtctttattcaggtttgtaacggggccaaggtacaggtgggataaacctaaggaatattaaggcataaatcgaagaggataa 22806882  T
117 agacgcatgaaattcattgaatagtgagtatgagtggtgtttgaaattaacaaaatataggaacataatagaactcaacaccataatttcttcatatcct 216  Q
    ||| ||||||| |||||||| |||  ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||    
22806883 agaagcatgaa-ttcattgagtagcaagtatgagtggtgtttgaaattaacaaaatacagcaacataatagaactcaacaccataatttcttcatatcct 22806981  T
217 atgattgctttttcacacgccttcacatcaaaatttgtccacaatacaactttcagcacaa 277  Q
    ||||| |||||||||||||||||||||||| || ||| |||||||||||||||||||||||    
22806982 atgatagctttttcacacgccttcacatcagaaattgcccacaatacaactttcagcacaa 22807042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University