View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_low_34 (Length: 324)
Name: NF14138_low_34
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 36052151 - 36051838
Alignment:
| Q |
1 |
gcatgatccctcgtgggcagtttatcgaacatgttccttgcgccggtgatagtaataacctctctggaacaaaaatgaaaagcacagtccctcttgggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36052151 |
gcatgatccctcgtgggcagtttatcgaacatgttcctcgcgacggtgatagtaataacttctctggaacaaaaatgaaaagcacagtccctcttgggaa |
36052052 |
T |
 |
| Q |
101 |
atttatcaaacaagttcgtcgtactgataaaagtgactacagtggctgggaatggatgtttcgatggacctgggtcatatggttcagtgtcagtgattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36052051 |
atttatcaaacaagttcgtcgtactgataaaagtgactacagtggctgggaatggatgtttcgatggacctgggtcatatggttcagtgtcagtgattga |
36051952 |
T |
 |
| Q |
201 |
tgcaaacataacaatgctggattttgtcgactctgccaataacagcacagggttactcttagatgggtcattatctggcggctttggtggaggcggtggg |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051951 |
tgcaaacataacaatgctggattttgttgactctgccaataacagcacagggttactcttagatgggtcattatctggcggctttggtggaggcggtggg |
36051852 |
T |
 |
| Q |
301 |
ggaacggcgaagcc |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36051851 |
ggaacggcgaagcc |
36051838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University