View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_low_63 (Length: 234)
Name: NF14138_low_63
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 25645238 - 25645339
Alignment:
| Q |
1 |
tccaccagggatcatactctgaagaatcttgaacctatcactgattctatgtcttctttctctagctgcaacactttgtggatcagttgaaagtttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25645238 |
tccaccagggatcatactctgaagaatcttgaacctatcactgattctatgtcttctttctctagctgcaacactttgtggatcagttgaaagtttcact |
25645337 |
T |
|
| Q |
101 |
ga |
102 |
Q |
| |
|
|| |
|
|
| T |
25645338 |
ga |
25645339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 25645383 - 25645449
Alignment:
| Q |
146 |
gaacatgacccataagtataagagatagtgttacactccatgtgctagctaagaaaattaatgaaag |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25645383 |
gaacatgacccataagaataagagatagtgttacactccatgtgctagctaagaaaattaatgaaag |
25645449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 84
Target Start/End: Complemental strand, 39073532 - 39073486
Alignment:
| Q |
38 |
tcactgattctatgtcttctttctctagctgcaacactttgtggatc |
84 |
Q |
| |
|
||||||||||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
39073532 |
tcactgattctttctcttctatgtctagctgcaacactttgtggatc |
39073486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 28934887 - 28934850
Alignment:
| Q |
22 |
aagaatcttgaacctatcactgattctatgtcttcttt |
59 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
28934887 |
aagaatcttgaacctatcactgattttatgccttcttt |
28934850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University