View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14138_low_63 (Length: 234)

Name: NF14138_low_63
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14138_low_63
NF14138_low_63
[»] chr7 (2 HSPs)
chr7 (1-102)||(25645238-25645339)
chr7 (146-212)||(25645383-25645449)
[»] chr8 (1 HSPs)
chr8 (38-84)||(39073486-39073532)
[»] chr6 (1 HSPs)
chr6 (22-59)||(28934850-28934887)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 25645238 - 25645339
Alignment:
1 tccaccagggatcatactctgaagaatcttgaacctatcactgattctatgtcttctttctctagctgcaacactttgtggatcagttgaaagtttcact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25645238 tccaccagggatcatactctgaagaatcttgaacctatcactgattctatgtcttctttctctagctgcaacactttgtggatcagttgaaagtttcact 25645337  T
101 ga 102  Q
    ||    
25645338 ga 25645339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 25645383 - 25645449
Alignment:
146 gaacatgacccataagtataagagatagtgttacactccatgtgctagctaagaaaattaatgaaag 212  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
25645383 gaacatgacccataagaataagagatagtgttacactccatgtgctagctaagaaaattaatgaaag 25645449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 84
Target Start/End: Complemental strand, 39073532 - 39073486
Alignment:
38 tcactgattctatgtcttctttctctagctgcaacactttgtggatc 84  Q
    ||||||||||| | |||||| | ||||||||||||||||||||||||    
39073532 tcactgattctttctcttctatgtctagctgcaacactttgtggatc 39073486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 28934887 - 28934850
Alignment:
22 aagaatcttgaacctatcactgattctatgtcttcttt 59  Q
    ||||||||||||||||||||||||| |||| |||||||    
28934887 aagaatcttgaacctatcactgattttatgccttcttt 28934850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University