View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_low_64 (Length: 233)
Name: NF14138_low_64
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 22806783 - 22806984
Alignment:
| Q |
18 |
acatgtacagatcaaaaggtctttattcaggtt-gtaacggggccaaggtacatgtgagataaacctaaggaatactaagccataaatcaaataggataa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||| |||| |||||||| || ||||||| |
|
|
| T |
22806783 |
acatgtacagatcaaaaggtctttattcaggtttgtaacggggccaaggtacaggtgggataaacctaaggaatattaaggcataaatcgaagaggataa |
22806882 |
T |
|
| Q |
117 |
agacgcatgaaattcattgaatagtgagtatgagtggtgtttgaaattaacaaaatataggaacataatagaactcaacaccataatttcttcatatcct |
216 |
Q |
| |
|
||| ||||||| |||||||| ||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22806883 |
agaagcatgaa-ttcattgagtagcaagtatgagtggtgtttgaaattaacaaaatacagcaacataatagaactcaacaccataatttcttcatatcct |
22806981 |
T |
|
| Q |
217 |
atg |
219 |
Q |
| |
|
||| |
|
|
| T |
22806982 |
atg |
22806984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University