View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_low_78 (Length: 203)
Name: NF14138_low_78
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 52 - 185
Target Start/End: Original strand, 31413077 - 31413210
Alignment:
| Q |
52 |
tgatcatgtggagcaagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtggtga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31413077 |
tgatcatgtggagcaagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtggtga |
31413176 |
T |
 |
| Q |
152 |
accgtgcaagtcaaataagagtaaatgcaattaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31413177 |
accgtgcaagtcaaataagagtaaatgcaattaa |
31413210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 66 - 182
Target Start/End: Complemental strand, 38014642 - 38014526
Alignment:
| Q |
66 |
aagatatcatattggtttgatacacacatttaatgcaccattggaatatggaaggggaaaatttgaatttcaaaccaatgtgg-tgaaccgtgcaagtca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38014642 |
aagatatcatattggtttgatacacacatttaatgcgccattggaatatggaagagg-aaatttgaatttcaaaccaatgtggttgaaccgtgcaagtca |
38014544 |
T |
 |
| Q |
165 |
aataagagtaaatgcaat |
182 |
Q |
| |
|
||||| | |||||||||| |
|
|
| T |
38014543 |
aataacaataaatgcaat |
38014526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University