View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1413_low_22 (Length: 235)
Name: NF1413_low_22
Description: NF1413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1413_low_22 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 111 - 235
Target Start/End: Original strand, 883523 - 883647
Alignment:
| Q |
111 |
gcgcaaccatataacctttaactctccaaagtcaggggtctcaacttcctcaaacccaaacatctgataactcattcaaatcaacaagtgatatgaagca |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
883523 |
gcgcaaccatataatctttaactctccaaagtcaggggtctcaacttcctcaaacccaaacatctgataactcgttcaaatcaacaagtgatatgaagca |
883622 |
T |
|
| Q |
211 |
ggaacacatacacgaaaattagaca |
235 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
883623 |
tgaacacatacacgaacattagaca |
883647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 883419 - 883505
Alignment:
| Q |
1 |
cctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctacgttgtatgagatggataagt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
883419 |
cctaagcggatatgagaggggtctttaacaggaatggaggatgatggagccagctcgccgttgctatgttgtatgagatggataagt |
883505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University