View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1413_low_23 (Length: 233)
Name: NF1413_low_23
Description: NF1413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1413_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 20 - 155
Target Start/End: Original strand, 32734900 - 32735035
Alignment:
| Q |
20 |
aatttagtccgtcacaatttgtcggatttagtatgtacaagaaatatattctaattagtcttagatattttcatgactaatttagtaatatatttgtctg |
119 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32734900 |
aatttagtccgtcacaatttatcggatttagtatgtacaagaaatatattctaattagtcttagatattttaatgactaatttagtaatatatttgtctg |
32734999 |
T |
 |
| Q |
120 |
aattgggtagcaagaaaattatgatgattaagtcga |
155 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
32735000 |
aattgggtagcaagaaaattgcgatgattaagtcga |
32735035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University