View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1413_low_25 (Length: 203)
Name: NF1413_low_25
Description: NF1413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1413_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 298162 - 298335
Alignment:
| Q |
14 |
atgaagatatagaaagtattgtttaccaggaagaatctcctgatgaacaagctctagtttctactgcctctgcttatagatgtacgcannnnnnngcaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
298162 |
atgaagatatagaaagtattgtttaccaggaagaatctcctgataaacaagctctagtttctactgcctctgcttatagatgtacgcattttttagcaaa |
298261 |
T |
 |
| Q |
114 |
ggatgtcttttttgacgtcaatggtgagaagatcaagtaaacagcgagttccatttagacttggtgggagatca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298262 |
ggatgtcttttttgacgtcaatggtgagaagatcaagtaaacagcgagttccatttagacttggtgggagatca |
298335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 27466211 - 27466156
Alignment:
| Q |
31 |
attgtttaccaggaagaatctcctgatgaacaagctctagtttctactgcctctgc |
86 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
27466211 |
attgattaccagggagaatcccctgatgaacaagctctagtttctgcggcctctgc |
27466156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University