View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1413_low_8 (Length: 448)
Name: NF1413_low_8
Description: NF1413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1413_low_8 |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 359; Significance: 0; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 9 - 432
Target Start/End: Complemental strand, 34437295 - 34436877
Alignment:
| Q |
9 |
gataatactgtgatattgcagttgagtttgaatagctctggagcagtagcttcagttccaaattcatcattctttggaaccagcttaaagaaagttacct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34437295 |
gataatactgtgatattgcagttgagtttgaatagctctggagcagtagcttcagttccaagttcatcattctttggaaccagcttaaagaaagttacct |
34437196 |
T |
 |
| Q |
109 |
cgaggttaccaaacacaaaggtttcatctggaagattcaaaattgttgctgctgagattgatgaaagcaagcaaactgacaaagacaaatggagaggttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34437195 |
cgaggttaccaaacacaaaggtttcatctggaagattcaaaattgttgctgctgagattaatgaaagcaagcaaactgacaaagacagatggagaggttt |
34437096 |
T |
 |
| Q |
209 |
ggcctatgatacttcagatgatcaacaagacatcacaagagggaagggtatggttgatacagttttccaagcaccacaagattctggaactcattatgca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34437095 |
ggcctatgatacttcagatgatcaacaagacatcacaagagggaagggtatggttgatacagttttccaagcaccacaagattctggaactcattatgca |
34436996 |
T |
 |
| Q |
309 |
gtcatgagttcttatgagtacattagtaccggacttagacagtaagtgagagatatacttaacatttttcttttggtggtgggcnnnnnnntttgaaccc |
408 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
34436995 |
gtcatgagttcttatgagtacattagtactggacttagacagtaagt--gagatatacttaacttttttcttttggtggtgggc---ggggtttgaaccc |
34436901 |
T |
 |
| Q |
409 |
cggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
34436900 |
cggcccttgcatatattatgcatt |
34436877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 434
Target Start/End: Original strand, 21139151 - 21139185
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatttg |
434 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21139151 |
tttgaaccccggaccttgcatatattatgcatttg |
21139185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 3389220 - 3389188
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
3389220 |
tttgaaccccagatcttgcatatattatgcatt |
3389188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 22522804 - 22522836
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22522804 |
tttgaaccccggaccttgcatatattatgcatt |
22522836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 31280077 - 31280045
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
31280077 |
tttgaaccccggatattgcatatattatgcatt |
31280045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 31877986 - 31877954
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
31877986 |
tttgaacccctgatcttgcatatattatgcatt |
31877954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 40715952 - 40715984
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40715952 |
tttgaaccccggaccttgcatatattatgcatt |
40715984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 42473952 - 42473920
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42473952 |
tttgaaccccggaccttgcatatattatgcatt |
42473920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 121; Significance: 8e-62; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 117 - 357
Target Start/End: Complemental strand, 30667115 - 30666875
Alignment:
| Q |
117 |
ccaaacacaaaggtttcatctggaagattcaaaattgttgctgctgagattgatgaaagcaagcaaactgacaaagacaaatggagaggtttggcctatg |
216 |
Q |
| |
|
||||||||||| ||||| || ||||| |||||| || ||||| ||||| ||||| | || || || ||| ||||| |||||| ||||||||||||| |
|
|
| T |
30667115 |
ccaaacacaaaagtttcctcaggaagcttcaaagtttttgctaaagagatcgatgagggtaaacagaccgacggagacagatggaggggtttggcctatg |
30667016 |
T |
 |
| Q |
217 |
atacttcagatgatcaacaagacatcacaagagggaagggtatggttgatacagttttccaagcaccacaagattctggaactcattatgcagtcatgag |
316 |
Q |
| |
|
||| |||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30667015 |
atatatcagatgaccaacaagacatcacaagaggaaagggtatggttgattcagttttccaagcaccacaagatactggaactcattatgcagtcatgag |
30666916 |
T |
 |
| Q |
317 |
ttcttatgagtacattagtaccggacttagacagtaagtga |
357 |
Q |
| |
|
||||||||||||| ||||||| ||||||| ||||| ||||| |
|
|
| T |
30666915 |
ttcttatgagtaccttagtactggacttaaacagtgagtga |
30666875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 10922311 - 10922343
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10922311 |
tttgaaccccggatcttgcatatattatgcatt |
10922343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 434
Target Start/End: Original strand, 24120423 - 24120457
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatttg |
434 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
24120423 |
tttgaaccgcggatcttgcatatattatgcatttg |
24120457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 913603 - 913635
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
913603 |
tttgaaccccggaccttgcatatattatgcatt |
913635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 428
Target Start/End: Complemental strand, 11358292 - 11358264
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatg |
428 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11358292 |
tttgaaccccggatcttgcatatattatg |
11358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 16663239 - 16663271
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
16663239 |
tttgaaccccggaccttgcatatattatgcatt |
16663271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 25727970 - 25728002
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25727970 |
tttgaaccccggaccttgcatatattatgcatt |
25728002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 34899155 - 34899123
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34899155 |
tttgaaccccggaccttgcatatattatgcatt |
34899123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 35126272 - 35126304
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35126272 |
tttgaaccccagatcttgcatatattatgcatt |
35126304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 38130962 - 38130994
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38130962 |
tttgaaccccggaccttgcatatattatgcatt |
38130994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 40575612 - 40575644
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcatt |
40575644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 41817557 - 41817525
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
41817557 |
tttgaaccccggaccttgcatatattatgcatt |
41817525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 45432006 - 45431974
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45432006 |
tttgaaccccggaccttgcatatattatgcatt |
45431974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 48315027 - 48315059
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48315027 |
tttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 48656902 - 48656934
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48656902 |
tttgaaccccggaccttgcatatattatgcatt |
48656934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 48849766 - 48849798
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48849766 |
tttgaaccccggaccttgcatatattatgcatt |
48849798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 51882203 - 51882235
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
51882203 |
tttgaaccctggatcttgcatatattatgcatt |
51882235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 18533727 - 18533695
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18533727 |
tttgaaccccggatcttgcatatattatgcatt |
18533695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 12748959 - 12748927
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12748959 |
tttgaaccccggaccttgcatatattatgcatt |
12748927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 15020819 - 15020787
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
15020819 |
tttgaaccccggatcttgcatatattatacatt |
15020787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 23159499 - 23159467
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
23159499 |
tttgaaccccgaatcttgcatatattatgcatt |
23159467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 32051535 - 32051567
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32051535 |
tttgaaccccggaccttgcatatattatgcatt |
32051567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 33105449 - 33105417
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33105449 |
tttgaaccccggaccttgcatatattatgcatt |
33105417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 42172246 - 42172278
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
42172246 |
tttgaactccggatcttgcatatattatgcatt |
42172278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 1794654 - 1794622
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1794654 |
tttgaaccccggatcttgcatatattatgcatt |
1794622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 432
Target Start/End: Original strand, 26256095 - 26256124
Alignment:
| Q |
403 |
gaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26256095 |
gaaccccggatcttgcatatattatgcatt |
26256124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 4302510 - 4302478
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
4302510 |
tttgaactccggatcttgcatatattatgcatt |
4302478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 12268987 - 12269019
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12268987 |
tttgaaccccggaccttgcatatattatgcatt |
12269019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 25533031 - 25532999
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25533031 |
tttgaaccccggaccttgcatatattatgcatt |
25532999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 29042595 - 29042563
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
29042595 |
tttgaaccccggatcttacatatattatgcatt |
29042563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 34521193 - 34521225
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34521193 |
tttgaaccccggaccttgcatatattatgcatt |
34521225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 34595930 - 34595898
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34595930 |
tttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 46707930 - 46707898
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
46707930 |
tttgaaccccggaacttgcatatattatgcatt |
46707898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 434
Target Start/End: Complemental strand, 27848216 - 27848182
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatttg |
434 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27848216 |
tttgaaccccggaccttgcatatattatgcatttg |
27848182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 8091161 - 8091193
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8091161 |
tttgaaccccggaccttgcatatattatgcatt |
8091193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 11175843 - 11175811
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
11175843 |
tttgaaccccagatcttgcatatattatgcatt |
11175811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 18693665 - 18693697
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18693665 |
tttgaaccctggatcttgcatatattatgcatt |
18693697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 20565078 - 20565110
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20565078 |
tttgaaccccggaccttgcatatattatgcatt |
20565110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 25186245 - 25186277
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25186245 |
tttgaaccccggaccttgcatatattatgcatt |
25186277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 29544685 - 29544653
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29544685 |
tttgaaccccggaccttgcatatattatgcatt |
29544653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 31543070 - 31543038
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31543070 |
tttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 31815890 - 31815922
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31815890 |
tttgaaccccggaccttgcatatattatgcatt |
31815922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 36359372 - 36359340
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
36359372 |
tttgaaccccggaccttgcatatattatgcatt |
36359340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 404 - 432
Target Start/End: Original strand, 39068715 - 39068743
Alignment:
| Q |
404 |
aaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39068715 |
aaccccggatcttgcatatattatgcatt |
39068743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 42791353 - 42791321
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42791353 |
tttgaaccccggaccttgcatatattatgcatt |
42791321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 432
Target Start/End: Original strand, 1285075 - 1285104
Alignment:
| Q |
403 |
gaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1285075 |
gaaccccggatcttgcatatattatgcatt |
1285104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 7670492 - 7670460
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7670492 |
tttgaaccccggaccttgcatatattatgcatt |
7670460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 10244785 - 10244753
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10244785 |
tttgaaccccggaccttgcatatattatgcatt |
10244753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 14046614 - 14046646
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14046614 |
tttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 14356644 - 14356676
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
14356644 |
tttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 18714506 - 18714474
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
18714506 |
tttgaaccccggaccttgcatatattatgcatt |
18714474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 19599203 - 19599171
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19599203 |
tttgaaccccggaccttgcatatattatgcatt |
19599171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 19626528 - 19626560
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19626528 |
tttgaaccccggaccttgcatatattatgcatt |
19626560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 20085762 - 20085794
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20085762 |
tttgaaccccggaccttgcatatattatgcatt |
20085794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 27462439 - 27462471
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27462439 |
tttgaaccccggaccttgcatatattatgcatt |
27462471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 39280821 - 39280853
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
39280821 |
tttgaaccccggaccttgcatatattatgcatt |
39280853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 42829237 - 42829269
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42829237 |
tttgaaccccggagcttgcatatattatgcatt |
42829269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 46737843 - 46737811
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
46737843 |
tttgaaccccggaccttgcatatattatgcatt |
46737811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 17)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 403 - 432
Target Start/End: Complemental strand, 19854620 - 19854591
Alignment:
| Q |
403 |
gaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19854620 |
gaaccccggatcttgcatatattatgcatt |
19854591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 433
Target Start/End: Original strand, 54294425 - 54294458
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcattt |
433 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
54294425 |
tttgaaccccggaccttgcatatattatgcattt |
54294458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 675976 - 675944
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
675976 |
tttgaaccccggaccttgcatatattatgcatt |
675944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 7230338 - 7230306
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7230338 |
tttgaaccccggaccttgcatatattatgcatt |
7230306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 8027400 - 8027432
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
8027400 |
tttgaacccccgatcttgcatatattatgcatt |
8027432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 11949766 - 11949798
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11949766 |
tttgaaccccggaccttgcatatattatgcatt |
11949798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 12322731 - 12322699
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12322731 |
tttgaaccccggaacttgcatatattatgcatt |
12322699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 14197434 - 14197466
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
14197434 |
tttgaaccccggatcttacatatattatgcatt |
14197466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 17423180 - 17423212
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17423180 |
tttgaaccccggaccttgcatatattatgcatt |
17423212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 19479480 - 19479512
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19479480 |
tttgaaccccggaccttgcatatattatgcatt |
19479512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 20383546 - 20383514
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20383546 |
tttgaaccccggaccttgcatatattatgcatt |
20383514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 20799397 - 20799429
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20799397 |
tttgaaccccggaccttgcatatattatgcatt |
20799429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 25783452 - 25783484
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25783452 |
tttgaaccccggaccttgcatatattatgcatt |
25783484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 36490626 - 36490594
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
36490626 |
tttgaaccccggatcttgcatacattatgcatt |
36490594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 44815999 - 44815967
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44815999 |
tttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 49041984 - 49042016
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
49041984 |
tttgaaccccggaccttgcatatattatgcatt |
49042016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 49953406 - 49953438
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
49953406 |
tttgaaccccggaccttgcatatattatgcatt |
49953438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Original strand, 1168 - 1200
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1168 |
tttgaaccccggaccttgcatatattatgcatt |
1200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 185321 - 185289
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
185321 |
tttgaaccccggatcttgcatattttatgcatt |
185289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 8569767 - 8569735
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8569767 |
tttgaaccccggaccttgcatatattatgcatt |
8569735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 8809364 - 8809332
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
8809364 |
tttgaacctcggatcttgcatatattatgcatt |
8809332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 12215811 - 12215779
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcatt |
12215779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 432
Target Start/End: Complemental strand, 33824939 - 33824907
Alignment:
| Q |
400 |
tttgaaccccggatcttgcatatattatgcatt |
432 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33824939 |
tttgaaccccggaccttgcatatattatgcatt |
33824907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University