View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14140_low_5 (Length: 291)
Name: NF14140_low_5
Description: NF14140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14140_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 15994129 - 15994208
Alignment:
| Q |
97 |
cattcagtcctctacaccttcattgcattaaggtgccttttacagttagaattgtttgtgcatatcaagatcccaaacca |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15994129 |
cattcagtcctctacaccttcattgcattaaggtgcctttttcagttagaattttttgtgcatatcaagatcccaaacca |
15994208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 15994244 - 15994280
Alignment:
| Q |
240 |
cgcttctacatgagcataagatgagtgtagcaataac |
276 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15994244 |
cgctcctacatgagcataagatgagtgtagcaataac |
15994280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University