View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14140_low_6 (Length: 280)
Name: NF14140_low_6
Description: NF14140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14140_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 6860531 - 6860763
Alignment:
| Q |
17 |
attgatcaacttatcagtatcatgcagtgttattgtttgttatagatttgttcagatatagtgttgacgtatatgattgaagaaactgtatctatggtat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6860531 |
attgatcaacttatcagtatcatgcagtgtgattatttgttatagatttgttcagatatagtattgacgtctatgattgaagaaactgtatctatggtat |
6860630 |
T |
 |
| Q |
117 |
cactttttcatttgacgattcaagtatatatcataaaataatctccaaagtatgatgaccaagcttagttttgtgttttagtgatgactttggtttacta |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6860631 |
cactttttcatttgacaattcaagtatatatcataaaataatctccaaagtatgatgaccaagcttagttttgtgttttagtgatgactttggtttacta |
6860730 |
T |
 |
| Q |
217 |
ttttctgatatatttttcacacttctccctatg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6860731 |
ttttctgatatatttttcacacttctccctatg |
6860763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University