View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14140_low_8 (Length: 245)
Name: NF14140_low_8
Description: NF14140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14140_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 37842858 - 37843092
Alignment:
| Q |
11 |
caaaaataagttacaattattattagtatcttctatcttctatactacattgcaatttaaatttagtttttcttaaacaagtatggtgatgatatggaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842858 |
caaaaataagttacaattattattagtatcttctatcttctatactacattgcaatttaaatttagtttttcttaaacaagtatggtgatgatatggaat |
37842957 |
T |
|
| Q |
111 |
catctctattaactaaatttgagttaacctcatgcaaacaatgtgatgatcttatatcatatttaatttctcatccttgatttatatcttttaataatta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37842958 |
catctctattaactaaatttgagttaacctcatgcaaacaatgtgatgatcttatatcatatttaatttctcatccttaatttatatcttttaataatta |
37843057 |
T |
|
| Q |
211 |
aacatcaaatttattagttttcatccactatatca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843058 |
aacatcaaatttattagttttcatccactatatca |
37843092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University