View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14140_low_9 (Length: 236)
Name: NF14140_low_9
Description: NF14140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14140_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 49259089 - 49259309
Alignment:
| Q |
1 |
tccttataaacataggtttctttagacagggtgaattttttattaatagttcacaactctttaggatgtatgttaagctaaactagaacattatgtattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49259089 |
tccttataaacataggtttctttagacagggtgaattttttattaatagttcacaactctttaggatgtatgttaagccaaactagaacattatgtattt |
49259188 |
T |
 |
| Q |
101 |
ttatagaatgttaagcccttccaaacaagggtgaattacaagtattgtaattgcagtatgatacacatgcagatgcagtgcagatgtagtgatgagtatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49259189 |
ttatagaatgttaagcccttccaaacaagggtgcattacaagtattgtaattgcagtatgatacacatgcagatgcagtgcagatgtagtgatgagtatg |
49259288 |
T |
 |
| Q |
201 |
tagattcaatgcagatgatac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49259289 |
tagattcaatgcagatgatac |
49259309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University