View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14141_low_3 (Length: 345)
Name: NF14141_low_3
Description: NF14141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14141_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 335
Target Start/End: Complemental strand, 45985023 - 45984712
Alignment:
| Q |
19 |
ccacaatccacgactttttgacatttgtatataatagaagggaagttttggtggttgatcagctgtggggtgcagttgttgcaccgctttaatttagtgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45985023 |
ccacaatccacgactttttgacatttgtatataatagaagggaagttttggtggttgatcagctgtggggtgcagttgttgcaccgcttta-----gtgt |
45984929 |
T |
 |
| Q |
119 |
tcggagcaatccggtttctatttgtgtcataggcgaattgaaggacctcctcgttgcaagaagagtaatggaaaccacttccaaccttgaggaccttcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45984928 |
tcggagcaatccggtttctatttgtgtcataggcgaattgaaggacctcctcgttgcaagaagagtaatggaaaccacttccaaccttgaggaccttcaa |
45984829 |
T |
 |
| Q |
219 |
aacaatttttcattatgcaatgaagtacaattcttcaaaatgattcaaattgtcgtctgtttttgagtagttaacgtaacaagggagtgtggcgacaagg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45984828 |
aacaatttttcattatgcaatgaagtacaattcttcaaaatgattcaaattgtcgtctgtttttgagtagttaacgtaacaagggagtgtggcgacaagg |
45984729 |
T |
 |
| Q |
319 |
ggaggtatgtgcctatg |
335 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45984728 |
ggaggtatgtgcctatg |
45984712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University