View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_27 (Length: 311)
Name: NF14142_high_27
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 296
Target Start/End: Complemental strand, 8320934 - 8320656
Alignment:
| Q |
21 |
atggctaatattttaacttaatattcatttcaaaataaaaaagtttaaacataaactattcaatctcaatcaagtattctatctacggttgcatgattgt |
120 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||| |
|
|
| T |
8320934 |
atggccaatattttaacttaatattcatttcaaaataaaaaagtttaaacataaactattcaatctcaatctagtattctatcttcgattgcatgattgt |
8320835 |
T |
 |
| Q |
121 |
atgaattgctaagaatccaaatccgactatccatgtc---attgcacatatcatccctggtactcttcactatgggctcgattcatagcctatattcact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8320834 |
atgaattgctaagaatccaaatccgactatcgatgtcattattgcacatatcatctctggtactcttcactatgggctcgattcatagcctatattcact |
8320735 |
T |
 |
| Q |
218 |
agggcatggcctatgcagnnnnnnnnnnactaatctttggaagagattaatttttatgcatcaatagtataaatttgtt |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8320734 |
agggcatggcctatgcagttttttttttactaatctttggaagagattaatttttatgcatcgatagtataaatttgtt |
8320656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 290
Target Start/End: Complemental strand, 31193142 - 31193103
Alignment:
| Q |
251 |
tctttggaagagattaatttttatgcatcaatagtataaa |
290 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31193142 |
tcttttgatgagattaatttttatgcatcaatagtataaa |
31193103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University