View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_28 (Length: 307)
Name: NF14142_high_28
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 2312338 - 2312462
Alignment:
| Q |
1 |
tgaggaagtgtgaaattatttattataacatgataaaataggaaaggtggaatgtggaaaagtatttgtggacagaatatgcccgcgttttcatcatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2312338 |
tgaggaagtgtgaaattatttattataacatgataaaataggaaaggtggaatgtggaaaagtatttgtggacagaatatgcccgcgttttcatcatgtg |
2312437 |
T |
 |
| Q |
101 |
ccaaacttaaccaactattcttcag |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2312438 |
ccaaacttaaccaactattcttcag |
2312462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 184 - 252
Target Start/End: Original strand, 2312533 - 2312601
Alignment:
| Q |
184 |
aaaatatgtcaatagcattaagaaaattgttggaaataatcttaaaacgcaatccaacatcttcagatg |
252 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2312533 |
aaaatatgtcaatagtactaagaaaattgttggaaataatcttaaaacgcaatccaacatcttcagatg |
2312601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 2311175 - 2311266
Alignment:
| Q |
33 |
ataaaataggaaaggtggaatgtggaaaagtatttgtggacagaatatgcccgcgttttcatcatgtgccaaacttaaccaactattcttca |
124 |
Q |
| |
|
||||||||||||| || |||| | |||| |||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2311175 |
ataaaataggaaatgtcaaatgcgaaaaaatatttgtggatagaatatgcccacattttcatcatgtgccaaacttaaccaactattcttca |
2311266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 169
Target Start/End: Original strand, 2312504 - 2312532
Alignment:
| Q |
141 |
gctatgttctgttctgttgaaacatattc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2312504 |
gctatgttctgttctgttgaaacatattc |
2312532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University