View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_30 (Length: 283)
Name: NF14142_high_30
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_30 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 25206150 - 25206432
Alignment:
| Q |
1 |
atactcgacatctgcaaccagtatgatgtggcactatccattggtgatggtttaagacctggatccatttatgatgcaaatgacacagctcaatttgccg |
100 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25206150 |
atacttgacatctgcaatcagtatgatgtggcactatccattggtgatggtttaagacctggatccatttatgatgcaaatgacacagctcaatttgccg |
25206249 |
T |
 |
| Q |
101 |
agcttttgacacaaggcgagctgactcgtagagcatgggaaaaggatgtacaggtgacataaatttacaaactttcttgatagcttggtactgataaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25206250 |
agcttttgacacaaggcgagctgactcgtagagcatgggaaaaggatgtacaggtgacataaatttacaaactttcttgatagcttgatactgataaatt |
25206349 |
T |
 |
| Q |
201 |
ttggaaatgttgaaataatttcgcctcaatttcaattttgatgttgaccttacaatgtattatttgtatgggtaacttctgct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25206350 |
ttggaaatgttgaaataatttcgcctcaatttcaattttgatgttgaccttacaatgtattatttgtatgggtaacttctgct |
25206432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 25194825 - 25195027
Alignment:
| Q |
1 |
atactcgacatctgcaaccagtatgatgtggcactatccattggtgatggtttaagacctggatccatttatgatgcaaatgacacagctcaatttgccg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25194825 |
atactcgacatctgcaatcagtatgatgtggcactatccattggtgatggtttaagacctggatccatttatgatgcaaatgacacagctcaatttgccg |
25194924 |
T |
 |
| Q |
101 |
agcttttgacacaaggcgagctgactcgtagagcatgggaaaaggatgtacaggtgacataaatttacaaactttcttgatagcttggtactg-ataaat |
199 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||||||||||||| ||| ||| ||||||||||| || |||| |||||| |||||| |
|
|
| T |
25194925 |
agcttttgacacaaggagaactcactcgtagagcatgggaaaaggatgtacaggtgatatatattatcaaactttctttattgctttgtactgaataaat |
25195024 |
T |
 |
| Q |
200 |
ttt |
202 |
Q |
| |
|
||| |
|
|
| T |
25195025 |
ttt |
25195027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University