View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_41 (Length: 235)
Name: NF14142_high_41
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_41 |
 |  |
|
| [»] scaffold0075 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 26 - 220
Target Start/End: Complemental strand, 14934398 - 14934204
Alignment:
| Q |
26 |
aaattaacctgtaatttggtcattcacaaggaaataatcagacttgttggctgaatatgagaagccaacaccaattcgagagtctaagtagatcatgtta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14934398 |
aaattaacctgtaatttggtcattcacaaggaaataatcagacttgttggctgaatatgagaagccaacaccaattggagagtctaagtagatcatgtta |
14934299 |
T |
 |
| Q |
126 |
gctactgcatgaagtagaaatataaattttttagtataagcnnnnnnngtatgaaaaatcaacaaaaatataagagacttattatgttacctttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
14934298 |
gctactgcatgaagtagaaatataaattttttagtataagcaaaaaaagtatgaaaaatcaacaaaaatataagagacttgttgtgttacctttg |
14934204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 120
Target Start/End: Complemental strand, 9939 - 9850
Alignment:
| Q |
31 |
aacctgtaatttggtcattcacaaggaaataatcagacttgttggctgaatatgagaagccaacaccaattcgagagtctaagtagatca |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
9939 |
aacctgtaatttggtcattcacaaaagcataatcagacttgttagctgaatatgagaaaccaacaccaattggagtgtctaagtagatca |
9850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 120
Target Start/End: Complemental strand, 11839 - 11750
Alignment:
| Q |
31 |
aacctgtaatttggtcattcacaaggaaataatcagacttgttggctgaatatgagaagccaacaccaattcgagagtctaagtagatca |
120 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
11839 |
aacctgtaatttggtcattcacaaaggcataatcagacttgttagctgaatatgagaaatcaacaccaattggagtgtctaagtagatca |
11750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 6840 - 6796
Alignment:
| Q |
111 |
aagtagatcatgttagctactgcatgaagtagaaatataaatttt |
155 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
6840 |
aagtagatcatgttagctactgcaaaatgtagaaaaataaatttt |
6796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University