View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_47 (Length: 212)
Name: NF14142_high_47
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 40266564 - 40266357
Alignment:
| Q |
1 |
ttgatataagaatggaaactatatgaaactttgtatatttgaaggcggttattgtgtatatgtaatgatccaattaattagttgatataacataaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40266564 |
ttgatataagaatggaaactatatgaaactttgtatatttgaaggcggttattgtgtatatgtaatgatccaattaattagttgatataacataaatgtt |
40266465 |
T |
 |
| Q |
101 |
acatatggtgcagagtaagataatttaagggagtgnnnnnnngaagctacaaaagcttgaattggaaggaaaagaaagagcagagaagatatatatagga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40266464 |
acatatggtgcagagtaagataatttaagggagtgaaaaaaagaagctacaaaagcttgaatgggaaggaaaagaaagagcagagaagatatatatagaa |
40266365 |
T |
 |
| Q |
201 |
gaatgaga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
40266364 |
gaatgaga |
40266357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University