View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_high_48 (Length: 211)
Name: NF14142_high_48
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 31158092 - 31157915
Alignment:
| Q |
19 |
atcagatttcgatagttgcaatggaaccaacgcacttgcggttatgacaaagcctccaactaaggtgtctttcagtctcagcactgtagggcaacaatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
31158092 |
atcagatttcgatagttgcaatggaaccaacgcacttgcggttatgacaaagcctccagctaaggtgtttttcaatctcagcactgtagggcaacaatat |
31157993 |
T |
 |
| Q |
119 |
ttcatatgtacctttcctggtcactgttctgctggtcagaaactgtcgatttacgt---tgaagtttatgttttacct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
31157992 |
ttcatatgtacctttcctggtcactgttctgctggtcagaaactgtcgattttcgttgatgaagtttatgttttacct |
31157915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University