View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_low_3 (Length: 667)
Name: NF14142_low_3
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 463 - 657
Target Start/End: Original strand, 32061845 - 32062039
Alignment:
| Q |
463 |
ttgttggatagaggtaaattccccttttggttatgtgatgcttcaatgatataccaccaatctttaacaatgttttcctttttctggtgttattgaattt |
562 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061845 |
ttgttggatagaggtaaattccccttttggttatgtgatgcttcaatgatataccaccaatctttaacaatgttttcctttttctggtgttattgaattt |
32061944 |
T |
 |
| Q |
563 |
gctaatctaaaagatttggcgaaaattcggattaattttgttagtttgttggaaggattgagaaattttttgggcttaactttggttgttctctg |
657 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061945 |
gctaatctaaaagatttggcgaaaattcggattaattttgttagtttgttggaaggattgagaaattttttgggcttaactttggttgttctctg |
32062039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 265 - 344
Target Start/End: Original strand, 32061626 - 32061705
Alignment:
| Q |
265 |
atgaagttttatagtatattaatttgattacgaatgagggttcttgaggaaattaaatgattaatttaatatgtttggtc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061626 |
atgaagttttatagtatattaatttgattacgaatgagggttcttgaggaaattaaatgattaatttaatatgtttggtc |
32061705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 32061505 - 32061562
Alignment:
| Q |
142 |
ataaaattattatgaagagggttcttgatgaaatgattaatgataagaattaagaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061505 |
ataaaattattatgaagagggttcttgatgaaatgattaatgataagaattaagaata |
32061562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 32061382 - 32061428
Alignment:
| Q |
18 |
atatgatggtagctgatgaatgcttttggtttttgaggaaatggtta |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061382 |
atatgatggtagctgatgaatgcttttggtttttgaggaaatggtta |
32061428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 396 - 441
Target Start/End: Original strand, 32061759 - 32061804
Alignment:
| Q |
396 |
cttgaggaaatgattaatgatagaactgttatgtttgaatttgaac |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061759 |
cttgaggaaatgattaatgatagaactgttatgtttgaatttgaac |
32061804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University