View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_low_44 (Length: 237)
Name: NF14142_low_44
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 12531098 - 12531299
Alignment:
| Q |
17 |
aaaattacaatgtatatttatactttaaaaaatgatatgttaaaattattagtactacaaatttatgagttttttatttgttgcctcggtatcataattt |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12531098 |
aaaattacaatatatatttatactttaaaaaatgatatgttaaaattattagtactacaaatttatgagttttttatttgttgcctctatatcataattt |
12531197 |
T |
|
| Q |
117 |
ctgagtccttccctgataacagatcatcatgtaagaagtataacttgcatgtggcatgtgtgagggagatgattgtggagagctggcatcagatgtatgt |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12531198 |
ctgagtccgtccctgataacagatcatcatgtaagaagtataacttgcatgtggcatgtgtgagggagatgattgtggagagctggcatcagatgtatgt |
12531297 |
T |
|
| Q |
217 |
cg |
218 |
Q |
| |
|
|| |
|
|
| T |
12531298 |
cg |
12531299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University