View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14142_low_44 (Length: 237)

Name: NF14142_low_44
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14142_low_44
NF14142_low_44
[»] chr1 (1 HSPs)
chr1 (17-218)||(12531098-12531299)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 12531098 - 12531299
Alignment:
17 aaaattacaatgtatatttatactttaaaaaatgatatgttaaaattattagtactacaaatttatgagttttttatttgttgcctcggtatcataattt 116  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
12531098 aaaattacaatatatatttatactttaaaaaatgatatgttaaaattattagtactacaaatttatgagttttttatttgttgcctctatatcataattt 12531197  T
117 ctgagtccttccctgataacagatcatcatgtaagaagtataacttgcatgtggcatgtgtgagggagatgattgtggagagctggcatcagatgtatgt 216  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12531198 ctgagtccgtccctgataacagatcatcatgtaagaagtataacttgcatgtggcatgtgtgagggagatgattgtggagagctggcatcagatgtatgt 12531297  T
217 cg 218  Q
    ||    
12531298 cg 12531299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University