View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_low_45 (Length: 237)
Name: NF14142_low_45
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 20989265 - 20989475
Alignment:
| Q |
11 |
tagattatactgtcagtgttgctaaatattggccatgaaggatagcggtgacggannnnnnnngacaatgtcatggtctatttgtgaaaggacggcagta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20989265 |
tagattatactgtcagtgttgctaaatattggccatgaaggatagcggtgacggattttttttgacaatgtcacggtctatttgtgaaaggacggcagta |
20989364 |
T |
|
| Q |
111 |
ctaaggtgtctatgctggatttttggctttctgtcatccgccattgatatcacttactacaatttagtaaatggttaatgttgttaaatagaggctataa |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20989365 |
ctatggtgtctatgctggatttttggctttctgtcatccgccattgatatcacttactacaatttagtaaatggttaatgttgttaaatagaggctatag |
20989464 |
T |
|
| Q |
211 |
cagcaatatac |
221 |
Q |
| |
|
|||| |||||| |
|
|
| T |
20989465 |
cagcgatatac |
20989475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University