View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_low_55 (Length: 208)
Name: NF14142_low_55
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 84 - 191
Target Start/End: Original strand, 14934429 - 14934535
Alignment:
| Q |
84 |
cttcaatgaatcatctcaataaacctcaagttctgttatttttacccttgattannnnnnnctctgaaacaatactaatcccttctctatatacagcaag |
183 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14934429 |
cttcaatgaatcatctcagtaaacctcaagttctgttatttttacccttgatta-ttttttctctcaaacaatactaatcccttctctatatacagcaag |
14934527 |
T |
|
| Q |
184 |
ggataact |
191 |
Q |
| |
|
|||||||| |
|
|
| T |
14934528 |
ggataact |
14934535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University