View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14142_low_57 (Length: 202)
Name: NF14142_low_57
Description: NF14142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14142_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 78 - 183
Target Start/End: Complemental strand, 22482736 - 22482631
Alignment:
| Q |
78 |
ttctattgcagtgactccaacagggcacaaccgagttccaaaatctccgcctacgcgccaccgacatcctgcgttgttgaaggatattccggaacgagga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22482736 |
ttctattgcagtgactccaacagggcacaaccgagttccaaaatctccgcctacgcgccaccgacatcctgcgttgttgaaggatattccggaacgagga |
22482637 |
T |
|
| Q |
178 |
tggaag |
183 |
Q |
| |
|
|||||| |
|
|
| T |
22482636 |
tggaag |
22482631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 78 - 183
Target Start/End: Complemental strand, 46753800 - 46753695
Alignment:
| Q |
78 |
ttctattgcagtgactccaacagggcacaaccgagttccaaaatctccgcctacgcgccaccgacatcctgcgttgttgaaggatattccggaacgagga |
177 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46753800 |
ttctattggagtgactctaacagggcacaaccgagttccaaaatctccgcctacgcgctaccgacatcctgcgttgttgaaggatattccggaacgagga |
46753701 |
T |
|
| Q |
178 |
tggaag |
183 |
Q |
| |
|
|||||| |
|
|
| T |
46753700 |
tggaag |
46753695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 29200980 - 29200932
Alignment:
| Q |
36 |
gaacctgtggttgaaggttgggcgcgttgccgtgaccttgtgttctatt |
84 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29200980 |
gaacctgtgattgaaggttgggcgcgttgccgtgaccttgtgttctatt |
29200932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University