View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14143_high_22 (Length: 241)

Name: NF14143_high_22
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14143_high_22
NF14143_high_22
[»] chr6 (1 HSPs)
chr6 (113-163)||(31405898-31405948)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 31405948 - 31405898
Alignment:
113 ttgttcatccaaaattcacttattagtagggttagagtgcacaccattgtt 163  Q
    |||||| |||||||| |||||||||||||||||||||||||||||| ||||    
31405948 ttgttcttccaaaatgcacttattagtagggttagagtgcacaccaatgtt 31405898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University