View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14143_high_36 (Length: 207)

Name: NF14143_high_36
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14143_high_36
NF14143_high_36
[»] chr2 (1 HSPs)
chr2 (1-190)||(32684174-32684363)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 32684174 - 32684363
Alignment:
1 atatagatccaaaatatgacaaaatttgcagaagttgatggatacgaagtttgggtgtccatcaagtgcataataaaaatacaacaacaatatatgaatt 100  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32684174 atatagatccaaaatatgacaaagtttgcacaagttgatggatacgaagtttgggtgtccatcaagtgcataataaaaatacaacaacaatatatgaatt 32684273  T
101 atgtccaaaataaaattattcaggaaggaaacaggcacgaataaaatgatatgcatgcatgaagaaatcatagattccaagggatttatt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
32684274 atgtccaaaataaaattattcaggaaggaaacaggcacgaataaaatgatatgcatgcatgaagaaatcatagattccatgggatttatt 32684363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University