View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_16 (Length: 288)
Name: NF14143_low_16
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 9 - 270
Target Start/End: Complemental strand, 2516679 - 2516418
Alignment:
| Q |
9 |
aatacgatatttgatggcattgtatcgccaaatacatttgttatctagatcatatgtttggtcgatgcctgatacgaggcagtgttatttttaatcattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516679 |
aatacgatatttgatggcattgtatcgccaaatacatttgttatttagatcatatgtttggtcgatgcctgatacgaggcagtgttatttttaatcattg |
2516580 |
T |
 |
| Q |
109 |
gattaaaaacaatgatcatatgactagtaatcatatttgctatcctctatgtgttgtctaaaagactctaaagtggtgttagtaaaagaaggagcaatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516579 |
gattaaaaacaatgatcatatgactagtaatcatatttgctatcctctatgtgttgtctaaaagactctaaagtggtgttagtaaaagaaggagcaatat |
2516480 |
T |
 |
| Q |
209 |
gattccctacaaatccatgcatataaccatcataactcacttgcattggttagtggttaggt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516479 |
gattccctacaaatccatgcatataaccatcataactcacttgcattggttagtggttaggt |
2516418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University