View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_19 (Length: 274)
Name: NF14143_low_19
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 45 - 263
Target Start/End: Original strand, 35090211 - 35090423
Alignment:
| Q |
45 |
aataaattttttgagattggcagcaaaggatggg-tttagcggagtgtcaacctaattgagatgttgttgcttctcttatgcaactcctttctcctggtc |
143 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| |||||||||| |||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
35090211 |
aataaattttttgagattgacagcaaaggatggggtttagcagagtgtcaacttaattgggatgtcgttgcttctcttatgcagctcctttctcctggtc |
35090310 |
T |
|
| Q |
144 |
tagcaaaaagattaaactaataaactaannnnnnnnacctagattaaatgacaactagtattaaacaattattccacaaaatggatccatatagcgacac |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35090311 |
tagcaaaaagattaaactaat-------ttttttttacctagattaaatgacaactagtattatacaattattccacaaaatggatccatatagcgacac |
35090403 |
T |
|
| Q |
244 |
aagattactacacaggttct |
263 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
35090404 |
aagattactacccaggttct |
35090423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University