View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_20 (Length: 252)
Name: NF14143_low_20
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 145 - 199
Target Start/End: Complemental strand, 9314222 - 9314168
Alignment:
| Q |
145 |
ggagtttttgggcaatggcttgtcatttcttgtggagttggaggaataaagaaaa |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9314222 |
ggagtttttgggcaatgacttgtcatttcttgtggagttggaggaataaggaaaa |
9314168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 36207912 - 36207956
Alignment:
| Q |
21 |
taaacctatgagatatatatgtaggacatctataaacaattttat |
65 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36207912 |
taaatctatgagatatatatgtaggacatctataaagaattttat |
36207956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 9767734 - 9767778
Alignment:
| Q |
21 |
taaacctatgagatatatatgtaggacatctataaacaattttat |
65 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
9767734 |
taaacctatgagatgtatatgtaggacatctataaagaattttat |
9767778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 198
Target Start/End: Complemental strand, 42625806 - 42625751
Alignment:
| Q |
143 |
aaggagtttttgggcaatggcttgtcatttcttgtggagttggaggaataaagaaa |
198 |
Q |
| |
|
||||| |||||||| |||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42625806 |
aaggactttttgggtaatgtcttgccatttcttgtggagttagaggaataaagaaa |
42625751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University