View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_23 (Length: 247)
Name: NF14143_low_23
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 8585878 - 8585653
Alignment:
| Q |
18 |
agttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttctcattggatggtttccctgcgctccaaagtattcacattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585878 |
agttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttaccgccttctcattggatggtttccctgcgctccaaagtattcacattt |
8585779 |
T |
|
| Q |
118 |
atggttgtcggagtctagagtccannnnnnnatatgaacgttctctcgctcgctcctcaaccatccaatgactttcaatcagtcgttgtaaggcactgcc |
217 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585778 |
atggctgtcggagtctagagtccatttttttatatgaacgttctctccctcgctcctcaaccatccaatgactttcaatcagtcgttgtaaggcactgcc |
8585679 |
T |
|
| Q |
218 |
tcaacagatggacaccctctctgctc |
243 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
8585678 |
tcaacagatggacaccctcactgctc |
8585653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 17850547 - 17850497
Alignment:
| Q |
75 |
ttctcattggatggtttccctgcgctccaaagtattcacatttatggttgt |
125 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
17850547 |
ttctcattggatggttttcctgcgctcgaaagacttcacatttatagttgt |
17850497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University