View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_24 (Length: 241)
Name: NF14143_low_24
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 31405948 - 31405898
Alignment:
| Q |
113 |
ttgttcatccaaaattcacttattagtagggttagagtgcacaccattgtt |
163 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
31405948 |
ttgttcttccaaaatgcacttattagtagggttagagtgcacaccaatgtt |
31405898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University