View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_27 (Length: 238)
Name: NF14143_low_27
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 10 - 221
Target Start/End: Original strand, 46959550 - 46959761
Alignment:
| Q |
10 |
acatgattataatcgatgaaaattatgaaatcagctattatattctacaaatcataaagacaattcaaaactatattggctatctcctcagataaataaa |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46959550 |
acatgattataattgatgaaaattatgaaatcagctattatattctacaaatcataaagacaattcaaaactatattggctatctcctcagataaataaa |
46959649 |
T |
 |
| Q |
110 |
tacaactattaataatgtgtcactgcatgcacatgtagacttacaaaacgaccctgcaaaaatatcttaaaattcaatacctgattcttgcatggaattc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46959650 |
tacaactattaataatgtgtcactgcatgcacatgtagacttgcaaaatgaccctgcaaaaatatcttaaaattcaatacctgattcttgcatggaagtc |
46959749 |
T |
 |
| Q |
210 |
gggaatcacagt |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46959750 |
gggaatcacagt |
46959761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 44522455 - 44522410
Alignment:
| Q |
160 |
accctgcaaaaatatcttaaaattcaatacctgattcttgcatgga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44522455 |
accctgcaaaaatatcttaaaattcaatacctgattcttgcatgga |
44522410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University