View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_30 (Length: 228)
Name: NF14143_low_30
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 98 - 211
Target Start/End: Original strand, 34799887 - 34800000
Alignment:
| Q |
98 |
tgctgtcatcgcagaaacaggaaccgggcagcagcaaacacatgaggctaacatatgccgaacagcaatacagcagcaccaaaacaacgaaccgcaatca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34799887 |
tgctgtcatcgcagaaacaggaaccgggcagcagcaaacacatgaggctaacatatgccgaacagcaatacagcagcaccaaaacaacgaaccgcaatca |
34799986 |
T |
|
| Q |
198 |
gcaaaaaaccacat |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34799987 |
gcaaaaaaccacat |
34800000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University