View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14143_low_39 (Length: 211)

Name: NF14143_low_39
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14143_low_39
NF14143_low_39
[»] chr5 (1 HSPs)
chr5 (1-211)||(27508199-27508409)
[»] chr4 (1 HSPs)
chr4 (146-211)||(35192866-35192931)
[»] chr7 (1 HSPs)
chr7 (146-211)||(44747927-44747992)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 27508409 - 27508199
Alignment:
1 ccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcgcggtggtagtaaggcgagaattgattgctgtggtgatggtattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
27508409 ccaccggagttgcaagatgatggtggtgaaggtaaccggctgtggaaggaggagcacggtggtagtaaggcgagaattgattgttgtggtgatggtattg 27508310  T
101 cggcggtggaggtggtgggtgtggccggttaaatgaactaaccggttcaccatcgatctctttgcgggggaagttccggagaaagttacaagctgcgcaa 200  Q
    |||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||| || |||||||||| ||||||    
27508309 cggcggtggaggtggtggctgtggccggttacatgaactaaccgtttcaccatcgatctctttgcggtggaagttccggtgacagttacaagcggcgcaa 27508210  T
201 ataacagcttc 211  Q
    |||||||||||    
27508209 ataacagcttc 27508199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 35192866 - 35192931
Alignment:
146 ttcaccatcgatctctttgcgggggaagttccggagaaagttacaagctgcgcaaataacagcttc 211  Q
    |||||||||||||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
35192866 ttcaccatcgatctctttgcggtggaagttctggtgacagttacaagcggcgcaaataacagcttc 35192931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 44747927 - 44747992
Alignment:
146 ttcaccatcgatctctttgcgggggaagttccggagaaagttacaagctgcgcaaataacagcttc 211  Q
    |||||||||||||||||||| | |||||||| || || |||||||||| |||||||||||||||||    
44747927 ttcaccatcgatctctttgcagtggaagttctggtgacagttacaagcggcgcaaataacagcttc 44747992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University