View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14143_low_40 (Length: 208)
Name: NF14143_low_40
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14143_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 22592974 - 22592805
Alignment:
| Q |
15 |
aatttttacatttgccattgtcacttctccaagttcttggactaacgggaaacattcaattatattcctaacccaattacactctagcatttcatcttca |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
22592974 |
aatttttacatgtgccattgtcacttctccaagttcttggactaacgggaaacattcagttatattcttaacccaattacactgtagcatttcaacttca |
22592875 |
T |
 |
| Q |
115 |
aaactaatggtatcaatactgataccagaacattcgttttttgagagatccaggaaatgatatcatgaatg |
185 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22592874 |
aaactaatggtatcaatactgatacaagaacattcgt-ttttgagagatccaggaaatgatatcatgaatg |
22592805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University