View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_high_22 (Length: 367)
Name: NF14145_high_22
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 7 - 355
Target Start/End: Original strand, 44149784 - 44150132
Alignment:
| Q |
7 |
gccgacatttgagccatgccagcaattagtcctccgtttttactgtcattgaagtaattgaagctgttggaattggaactaagttgaagggttgaagaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44149784 |
gccgacatttgagccatgccagcaattagtcctccgtttttactgtcattgaagtaattgaagctgttggaattggaactaagttgaagggttgaagaag |
44149883 |
T |
 |
| Q |
107 |
atggaggcaaggtttttgggccaccaaaaagtgcacctgcactagttgagaacatgccaccgcatgcgttgttggttgatctgaatgatgttggagcatg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44149884 |
atggaggcaaggtttttgggccaccaaaaagtgcacctgcactagttgagaacatgccaccgcatgcattgttggttgatctgaatgatgttggagcatg |
44149983 |
T |
 |
| Q |
207 |
ttcttgagatggggatcttagtgagtttttagggtcatagtcattgtttaattctgaggaagtgttggaaacaggttttagaggcattgtagaaatagga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44149984 |
ttcttgagatggggatcttagtgagtttttagggtcatagtcattgtttaattctgaggaagtgttggaaacaggttttagaggcatggtagaaatagga |
44150083 |
T |
 |
| Q |
307 |
tcatgcatttggctttgcaagtttggtggcatgccactagttaatcctt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44150084 |
tcatgcatttggctttgcaagtttggtggcatgccactagttaatcctt |
44150132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University