View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_high_37 (Length: 270)
Name: NF14145_high_37
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 4865344 - 4865213
Alignment:
| Q |
127 |
gctttcttaataaaaattacatactccaatgatgtatgggaaattttacccctctttcatttacatgaccagctctttcacttaatgagagtgagagttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4865344 |
gctttcttaataaaaattacatactccaatgatgtatgggaaattttacctctatttcatttacaggaccagctctttcacttaatgagagtgagagttt |
4865245 |
T |
 |
| Q |
227 |
aaaatatgaaaatggtgatgtagtcgccactg |
258 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
4865244 |
aaaatatgataatggtgatgtagtcgccactg |
4865213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 14 - 93
Target Start/End: Complemental strand, 4865431 - 4865344
Alignment:
| Q |
14 |
atgaaaatgaaatctttcctaattaagagataacttgc--------ctaactgtctttagtgatgttatgtgccctctttctcatctg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4865431 |
atgaaaatgaaatctttcctaattaagagataacttgcgctccaagctaactgtctttagtgatgttatgtgccctctttctcatctg |
4865344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University