View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_high_44 (Length: 238)
Name: NF14145_high_44
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 38056819 - 38057045
Alignment:
| Q |
1 |
ggatatgttagtaatgttattagatatctaaaatatcctagagacctctgacccatgggaggattgacttcttgtttttgcatcttttctacagaatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
38056819 |
ggatatgttagtaatgttattagatatctaaaatatcctagagacctctgatccatgggaggattgacttcttgtttttgtatcttctctacagaatgca |
38056918 |
T |
|
| Q |
101 |
aataacactgaactcaagatggcatgggattgctacttaaatgcaaatgaaagttggcaaaatactgaagctaaaatacaaactaagagagagcacaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056919 |
aataacactgaactcaagatggcatgggattgctacttaaatgcaaatgaaagttggcaaaatactgaagctaaaatacaaactaagagagagcacaagg |
38057018 |
T |
|
| Q |
201 |
tttagtgtttgaatctgcccatttctt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38057019 |
tttagtgtttgaatctgcccatttctt |
38057045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University