View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_high_48 (Length: 231)
Name: NF14145_high_48
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 13 - 161
Target Start/End: Complemental strand, 32047704 - 32047556
Alignment:
| Q |
13 |
gcaaaggatgcaagatgtcatgtgatgtcatcttagctggttttgatgatgtcacctcatttcttgtgtagtacgatcaaaatgttttggagaatgttct |
112 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
32047704 |
gcaatggatgcaagctgtcatgtgatgtcatcttagctggttttgatgatgtcatctcatttcttgtgtagtacgatcaaaaggttttggagaatgttat |
32047605 |
T |
 |
| Q |
113 |
ggtctatgcttgatatcattctcgacaaaacaaatcttgttttaagtcc |
161 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32047604 |
ggtctatgcttgagatcattctcgacaaaacaaatcttgttttaagtcc |
32047556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Complemental strand, 32047528 - 32047495
Alignment:
| Q |
182 |
ggaagagattaataatggtggaaaacaataaaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32047528 |
ggaagagattaataatggtggaaaacaataaaat |
32047495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University