View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_low_40 (Length: 282)
Name: NF14145_low_40
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 43089241 - 43089496
Alignment:
| Q |
17 |
ccaatatcataactgttcattgtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtaaactcgttcctgttactctcattgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43089241 |
ccaatatcataactgttcattgtagcatcaaaagatgatgataatcttctgctgtgaataggaattgaagctgtgtactcgttcctgttactctcattgt |
43089340 |
T |
 |
| Q |
117 |
gattgtacctttcctgcaaaataaaaatcataagaaatgtaaatattcaagtgatactaggaattagaatatgagatctgtttatgtattttaccgtgga |
216 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43089341 |
gattatacctttcctgcaaaataacaatcataagaaatgtaaatattcaagtgatactaggaattaaaatatgagatctgtttatgtattttaccgtgga |
43089440 |
T |
 |
| Q |
217 |
tcttctagcttgtgtttgaaatctgttatttgtttcattctttgtgtttatgatga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43089441 |
tcttctagcttgtgtttgaaatctgttatttgtttcattctttgtgcttatgatga |
43089496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University