View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14145_low_41 (Length: 270)

Name: NF14145_low_41
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14145_low_41
NF14145_low_41
[»] chr7 (2 HSPs)
chr7 (127-258)||(4865213-4865344)
chr7 (14-93)||(4865344-4865431)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 4865344 - 4865213
Alignment:
127 gctttcttaataaaaattacatactccaatgatgtatgggaaattttacccctctttcatttacatgaccagctctttcacttaatgagagtgagagttt 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||    
4865344 gctttcttaataaaaattacatactccaatgatgtatgggaaattttacctctatttcatttacaggaccagctctttcacttaatgagagtgagagttt 4865245  T
227 aaaatatgaaaatggtgatgtagtcgccactg 258  Q
    ||||||||| ||||||||||||||||||||||    
4865244 aaaatatgataatggtgatgtagtcgccactg 4865213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 14 - 93
Target Start/End: Complemental strand, 4865431 - 4865344
Alignment:
14 atgaaaatgaaatctttcctaattaagagataacttgc--------ctaactgtctttagtgatgttatgtgccctctttctcatctg 93  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||    
4865431 atgaaaatgaaatctttcctaattaagagataacttgcgctccaagctaactgtctttagtgatgttatgtgccctctttctcatctg 4865344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University