View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_low_45 (Length: 252)
Name: NF14145_low_45
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 13441678 - 13441846
Alignment:
| Q |
1 |
ctaaatctcaaaccgaagttgtagagacaaaccttcaaccaaatgaccttttaaagacagacagtttaaattcgtactctatagacaattaaattggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13441678 |
ctaaatctcaaaccgaagttgtagagacaaacgttcaaccaaatgaccttttaaagacagacagtttaaattcgtactctatagacaattaaattggagg |
13441777 |
T |
 |
| Q |
101 |
cccttctgtcctacttaggtgcgagtatggtgacttcatctttttctctcttctatcaatcattccctc |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13441778 |
cccttctgtcctacttgggtgcgagtatggtgacttcatctttttctctcttctatcaatcattccctc |
13441846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University