View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_low_51 (Length: 232)
Name: NF14145_low_51
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 38730303 - 38730084
Alignment:
| Q |
1 |
tttgtggagtttat-attccaaccatatttgttctatttacaagatatgaatacaagacaatacttaacgcttgatggtaacacaataggattggttgag |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38730303 |
tttgtggagtttatcattccaaccatatttgttctatttacaagatatgaatacaagacaatacttaacgcttgatggtaacataataggattggttgag |
38730204 |
T |
|
| Q |
100 |
tttaagtgtgagtgattagtttcacatggcttataaacgagtaaaatgtttaatatacgagatagaagactcgcatacctaatattttaaggtttttgac |
199 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38730203 |
tttaagtgtgagtgattagtttcacatcgtttataaacgagtaaaatgtttaatatacgagatagaagactcgcatatctaatattttaaggtttttgac |
38730104 |
T |
|
| Q |
200 |
ggagattaatgtcattctct |
219 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
38730103 |
agagattagtgtcattctct |
38730084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University