View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14145_low_55 (Length: 217)
Name: NF14145_low_55
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14145_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 73 - 184
Target Start/End: Complemental strand, 15926728 - 15926615
Alignment:
| Q |
73 |
aaatgatttaattttgctct--tgtggaaaaatttacaccaacccggatagggatatccatgtacaaatgtaaatgaaatatttacctataagtcatttt |
170 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15926728 |
aaatgatttaattttgctctcttgtggaaaaatttacaccaacccggatagggatatccatgtacaaatgtaaatgaaatatttacctataagtcatttt |
15926629 |
T |
 |
| Q |
171 |
gacaatttcacatt |
184 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
15926628 |
gacgatttcacatt |
15926615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 15926848 - 15926799
Alignment:
| Q |
30 |
cttttgtaatgaaatcttatgttgggtttattccgaggtaaacaaatgat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15926848 |
cttttgtaatgaaatcttatgttgggtttattcggaggtaaacaaatgat |
15926799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University