View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_11 (Length: 382)
Name: NF14146_high_11
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 13 - 365
Target Start/End: Original strand, 32189271 - 32189623
Alignment:
| Q |
13 |
attctcatactatcaaaaccatatttacaaaaacaatattctttttcaaaatctatcttggtctaatggtaggtatgtcaccactaacaaggtcactacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189271 |
attctcatactatcaaaaccatatttacaaaaacaatattctttttcaaaatctatcttggtctaatggtaggtatgtcaccactaacaaggtcactacc |
32189370 |
T |
 |
| Q |
113 |
caaaatatctcctgaaactataaaaggagtctttatattagatgatgagggttgtgaactaaatgtggttccagaatcacttaagtcataatcagctccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189371 |
caaaatatctcctgaaactataaaaggagtctttatattagatgatgagggttgtgaactaaatgtggttccagaatcacttaagtcataatcagctccc |
32189470 |
T |
 |
| Q |
213 |
tttttggcatggtactcaggcatcatagtcaatatgatttcaagctctctagccacttctgccatttttggcctttcatctggtgaatctttgcagcact |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32189471 |
tttttggcatggtactcaggcatcatagtcaatatgatttcaagctctctagccacttctgccattttaggcctttcatctggtgaatctttgcagcact |
32189570 |
T |
 |
| Q |
313 |
ttaaacccaatttcaaaagcttttccacacactcagaagtgtaaaatcccatt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189571 |
ttaaacccaatttcaaaagcttttccacacactcagaagtgtaaaatcccatt |
32189623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University