View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_12 (Length: 370)
Name: NF14146_high_12
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 16 - 359
Target Start/End: Complemental strand, 31863684 - 31863341
Alignment:
| Q |
16 |
acaactgctcaagttaagttgtctgagtatgttatcagaagccacggtaacctagccactcaagcagagcaagttgaggttaacttttatctattcattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31863684 |
acaactgctcaagttaagttgtctgagtatgttatcagaagccacggtaacctagccactcaagcagagcaagttgaggttaacttttatctattcattg |
31863585 |
T |
 |
| Q |
116 |
tactcttccttttctatatgttagaatttagataccattttcttttagtggtttattacttatttgtattgttccaannnnnnnccgcagatgtatgaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31863584 |
tactcttccttttctatatgttagaatttagataccattttcttttagtggtttattacttatttgtattgttccaatttttttccgcagatgtatgaat |
31863485 |
T |
 |
| Q |
216 |
ccatgagggctgtcacatgggcactgtttgctagtcgaaaagctctcaactcgataactgtcaagtataggaatggttttgtccaagcatttcatagaga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31863484 |
ccatgagggctgtcacatgggcactgtttgctagtcgaaaagctctcaactcgataactgtcaagtataggaatggttttgtccaagcatttcatagaga |
31863385 |
T |
 |
| Q |
316 |
cttgaaggataataatattttttacatctacactgatctttcat |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31863384 |
cttgaaggataataatattttttacatctacactgatctttcat |
31863341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University